You have no items in your shopping cart.
CD138 protein
SKU: orb763303
Description
Research Area
Epigenetics
Images & Validation
−
| Application Notes |
|---|
Key Properties
−| Expression System | E.coli |
|---|---|
| Tag | His-tag |
| Molecular Weight | ~45kDa |
| Expression Region | pet-22b(+) |
| Protein Sequence | CAGATTGTTGCAACCAATCTGCCGCCGGAAGATCAGGATGGCAGTGGCGATGATAGTGATAACTTCAGCGGCAGTGGTGCCGGCGCCCTGCAGGATATTACCCTGAGTCAGCAGACCCCGAGTACCTGGAAAGATACCCAGCTGCTGACCGCCATTCCGACCAGTCCGGAACCGACCGGCCTGGAAGCAACCGCAGCAAGCACCAGTACCCTGCCGGCAGGCGAAGGTCCGAAAGAAGGTGAAGCCGTTGTGCTGCCGGAAGTGGAACCGGGCCTGACCGCCCGTGAACAGGAAGCCACCCCGCGTCCGCGCGAAACCACCCAACTGCCGACCACCCATCTGGCAAGCACCACCACCGCAACCACCGCCCAGGAACCGGCAACCAGCCATCCGCATCGCGATATGCAGCCGGGTCATCATGAAACCAGCACCCCGGCAGGTCCGAGCCAGGCTGATCTGCATACCCCGCATACCGAAGATGGCGGTCCGAGTGCCACCGAACGTGCAGCAGAAGATGGTGCAAGTAGTCAGCTGCCGGCCGCCGAAGGCAGCGGTGAACAGGACTTCACCTTCGAAACCAGTGGCGAAAATACCGCAGTTGTGGCAGTTGAACCGGATCGCCGCAATCAGAGTCCGGTGGATCAGGGTGCCACCGGTGCCAGTCAGGGCCTGCTGGATCGTAAAGAAGTGCTGGGT |
| Purification | Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE). |
Storage & Handling
−| Storage | Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles. |
|---|---|
| Buffer/Preservatives | PBS, 4M Urea, pH 7.4 |
| Concentration | > 0.5mg/ml |
| Expiration Date | 6 months from date of receipt. |
| Disclaimer | For research use only |
Similar Products
−- Item 1 of 1
- Item 1 of 1
- Item 1 of 1
Recombinant Mouse SDC1 Protein [orb2992551]
SDS-PAGE: Greater than 95% as determined by reducing SDS-PAGE. (QC verified)
Predicted: 51.1 KDa. Observed: 65-110 KDa, reducing conditions
1 mg, 500 μg, 50 μg, 10 μgRecombinant Human SDC1 Protein [orb2994757]
Unconjugated
SDS-PAGE: Greater than 95% as determined by reducing SDS-PAGE.
Predicted: 51 KDa. Observed: 80-90 KDa, reducing conditions
10 μg, 50 μg, 500 μg, 1 mg
Quality Guarantee
Explore bioreagents carefree to elevate your research. All our products are rigorously tested for performance. If a product does not perform as described on its datasheet, our scientific support team will provide expert troubleshooting, a prompt replacement, or a refund. For full details, please see our Terms & Conditions and Buying Guide. Contact us at support@biorbyt.com.
Quick Database Links
UniProt
UniProt Details
− No UniProt data available
Documents Download
Datasheet
Product Information
Request a Document
Protocol Information
CD138 protein (orb763303)
- 0.0
Based on 0 reviews
Participating in our Biorbyt product reviews program enables you to support fellow scientists by sharing your firsthand experience with our products.
Login to Submit a ReviewAvailable Sizes
Select a size below
Usually dispatched within 5-10 working days